Double defense: enhancing tobacco with cyanobacterial and thaumatin genes

Global climate change exacerbates both abiotic and biotic stress factors, which affect not only agricultural crops but also native plant species that must adapt to rapidly changing ecosystems (Raza et al., 2025).One of the universal mechanisms of plant resistance to abiotic factors is an increase in the proportion of unsaturated fatty acids in membrane phospholipids (Xiao et al., 2022). Desaturases are enzymes that promote the formation of double bonds in fatty acids, converting them from saturated to unsaturated, which increases the plasticity and viscosity of membranes while lowering the crystallisation temperature, thereby improving plant resistance to a number of abiotic stress factors (Yu et al., 2021). In addition to abiotic stress, the physiological health and productivity of plants hinge on various factors, including susceptibility to fungal and viral pathogens, which can hinder plant development, disrupt photosynthesis, and impair essential biochemical processes (Yang and Luo, 2021). Interestingly, abiotic stressors can sometimes create favourable conditions for pathogen development (Ortel et al., 2024). Some of the plants defence mechanisms are aimed at preventing pathogen entry, while others inhibit the progression of infections within the plant (El-Saadony et al., 2022). In many plant species, Thaumatin-Like Proteins (TLPs), which are structurally related to thaumatin II, are prevalent (Zhao et al., 2024), and show antifungal activity based on their capacity to disrupt the cell walls of pathogenic fungi (Osei-Obeng et al., 2024). These proteins have β-1,3-glucanase activity and can bind to degrade β-1,3-glucan, a fundamental component of fungal cell walls, facilitating further membrane destruction (Liu et al., 2021). Moreover, thaumatins may influence the activity of other proteins through metabolic pathway regulation (Zhao et al., 2024). In this study, we introduced the cyanobacterium Δ-12-acyl-lipid desaturase gene (desA) from Synechocystis sp. PCC 6803 and the thaumatin II gene, (thII) from Thaumatococcus daniellii into the Nicotiana tabacum genome. The presence of a transgene in a plant can yield both advantageous and detrimental outcomes, as gene expression and protein functionality require additional resources, potentially leading to biochemical and physiological competition. Therefore, the desA gene was placed in a vector regulated by the cold-inducible CBF1 promoter from Arabidopsis thaliana. This study aimed to explore the concurrent functioning of these two transgenes in tobacco plants, which, through the simultaneous expression of two proteins with different substrate specificities, would exhibit augmented resistance to both abiotic and biotic stressors.This research used cloned sequences of the desA gene, which encodes the Δ12-acyl-lipid desaturase from Synechocystis sp. PCC 6803, and the thII gene from Thaumatococcus daniellii, which encodes a sweet-tasting thaumatin II protein structurally related to the TLP family. The desaturase genes were translationally fused to the licBM3 gene, which encodes a reporter protein derived from the thermostable lichenase of Clostridium thermocellum. The hybrid genes, desA:licBM3, were cloned into pBISN-based vectors containing the selectable nptII gene, regulated by the cold-induced promoter CBF1 from the Arabidopsis thaliana. The thaumatin II gene was integrated into a pNMD46732-based vector, with a selectable bar, under the control of the constitutive 35S cauliflower mosaic virus (CaMV) DNA promoter. Control groups included transgenic plants with vector constructs incorporating the GFP reporter gene instead of the desaturase gene (desA), as well as wild-type tobacco (Nicotiana tabacum). All genetic constructs and transgenic plants were sourced from the collection at the Institute of Cell Biology and Genetic Engineering.Leaf blades measuring 1-1.5 cm² were excised and placed into a bacterial suspension, which was incubated for one hour at +25 °C in the dark. The explants were then collected, washed to remove excess bacterial culture, and transferred to MS medium. They were co-cultivated with Agrobacterium for two days at +25 °C (to promote Agrobacterium growth). After co-cultivation, the explants were washed in sterile distilled water, dried on sterile filter paper for 10-15 minutes, and then placed in MS medium supplemented with the phytohormones BAP (1 µg mL - 1 ) and NAA (0.1 µg mL -1 ), along with 700 µg mL -1 cefotaxime to inhibit Agrobacterium growth.Regeneration of potential transgenic shoots was monitored over a period of 2-3 weeks, with regeneration occurring in vitro at 25 ± 3ºC under a 16-hour photoperiod with light intensity of 100 μmol quanta (m²s).Plant DNA was isolated using a standard CTAB method (Mark et al., 2024), and its concentration was determined by measuring optical density at 260 nm with a BioPhotometer spectrophotometer (Eppendorf, Germany). PCR was conducted using a 2720 Thermal Cycler (Applied Biosystems, USA), with primers thII-f (caccttcgagatcgtcaaccgctg) and thII-r (aagcttaggcagtagggcagaaagtg). Amplification conditions included 5 minutes at 94ºC; 30 cycles of 30 seconds at 94ºC, 45 seconds at 63ºC, and 45 seconds at 72ºC; followed by 5 minutes at 63ºC. Amplification products were separated via 1% agarose gel electrophoresis using TAE buffer and visualized with ethidium bromide. The O'GeneRuler 1kb DNA Ladder (Fermentas, Lithuania) served as a DNA marker.The preparation of plant material and the reaction were carried out according to the protocol described earlier (Gerasymenko et al., 2015). A qualitative lichenase assay and part of analysis of the FA was conducted 40 minutes after exposure to cold stress (0°C for 30 minutes, followed by -5°C for 80 minutes) Blind organoleptic test Four colleagues who were not involved in the research will participate in the test (A, B, C, D). The same amount of material was taken, and the lines were numbered in random order. The criterion for determination was the presence or absence of a sweet taste. Water and bread were used to eliminate the residual taste. For safety reasons, the plant test material (approximately 100 mg) could be chewed rather than swallowed. Analysis of the fatty acid spectrum by gas chromatography and mass spectrometry Samples for gas chromatography and mass spectrometry analysis were prepared according to previously published protocols (Gerasymenko et al., 2015). The analysis was conducted using an Agilent 6890N / 5973 inert chromatographic-mass spectrometry system equipped with a DBFFAP capillary column (J&W Scientific, United States). Fatty acid methyl esters (FAMEs) were identified by comparing the obtained spectra with entries from the NIST 02 mass spectrum library and standard mixtures of bacterial FAMEs (47080U, Supelco). For fatty acid analysis, mixed plant material from three lines of N. tabacum CBF1:desA:licBM3+thII, three lines of N. tabacum CBF1:desA:licBM3, two lines of N. tabacum CBF1:GFP:licBM3 obtained from transgenic plants, and N. tabacum were used. Six biological replicates and one analytical replicate were selected (upper unfolded leaves). The statistical significance of differences between average means was estimated using Student's paired ttest, p-values were calculated using Excel standard functions.The genetic transformation of transgenic Nicotiana tabacum, which demonstrated the insertion and expression of the desA gene, was carried out using a plasmid vector containing the thII gene. The active regeneration phase of the plants was observed within 1-1.2 months (Figure 1.A). Two months post-transformation, regenerants were cultured on standard MS medium. After biomass growth, the presence of the thII gene insertion was confirmed via PCR (Figure 1.B,C).The expression of the desaturase gene was indirectly assessed through the activity of the thermostable lichenase reporter protein (licBM3), since both the desaturase and lichenase genes are located within the same reading frame under the control of the cold-inducible promoter. The assay evaluates the lichenase's ability to degrade the complex carbohydrate lichenan (Figure 1.D). The number of replicates for gene insertion detection and lichenase activity testing was 3, all of which were positive. Since thaumatin is used as a sweetener, the expression of the gene was verified using the blind organoleptic test. It was conducted only among institute employees, under personal responsibility, without the support or approval of any official body. All three N. tabacum thII+desA lines tested were determined to be positive for sweet taste, with the exception of N. tabacum thII+desA Line2, where one participant was unable to detect the sweet taste, which may be due to the masking of the taste by the natural bitter taste of tobacco. (Figure 1.D). Results indicated that the plants maintained lichenase activity, suggesting the continued expression of the desA gene and lichenase activity. Tobacco plants demonstrating confirmed insertion and expression of the 12-acyl-lipid desaturase genes exhibited heightened linoleic acid content. To compare fatty acid spectra, tobacco plants expressing both the desA and thII genes, those expressing only the desA gene, those with the GFP:licBM3 gene insertion, and wild-type tobacco plants were analyzed. The upper open leaves were utilized for this analysis, which was performed under normal physiological conditions and following cold stress exposure. An increase in linoleic acid (C18:2) proportion was observed in plants with the desA gene insertion, differing from the fatty acid spectrum analysis results of the transgenic control and wild-type tobacco plants. No significant distinctions in fatty acid composition between plants with the desaturase gene and those with both desaturase and thaumatin gene insertions were observed (Table 1). Developing biotechnological plants with transgenes that enhance resistance to various stress types represents a highly promising area of research (Ricroch et al., 2022). Currently, several biotechnological methods are employed to create new plant varieties via molecular breeding techniques (Sun et al., 2024). However, the effects of transgenes within plant organisms remain an inadequately explored subject (Fenzi et al., 2024). The influence of desaturase transgene expression on plant resistance to various abiotic factors is well-documented in many studies (Kumari et al., 2025), primarily because the proteins encoded by this gene have binding substrates within the plant due to their phylogenetic similarity to plant desaturases (Laureano et al., 2021). Similarly, thaumatin II protein is functionally relevant to plants (Hu et al., 2025). This paper presents preliminary findings on the generation of double transformants in tobacco plants, confirming the insertion of two different transgenes: the cyanobacterial desaturase and thaumatin II. However, the expression and pleiotropic effects of certain transgenes under stressful conditions may negatively affect or suppress the functionality of others (Cabrera et al., 2022), performing the functions of less stable proteins. This study aimed to elucidate how the expression of the desA gene, encoding Δ12-acyl-lipid desaturase from Synechocystis sp. PCC 6803, and the insertion of the thII gene from Thaumatococcus daniellii influence the function of these genes. TLPs are known to stabilize under extreme thermal and pH conditions due to their disulfide bridge structures, as well as resist protein degradation, potentially impacting the functionality of other proteins (Feng et al., 2024). So far, we have observed sustained expression of the desaturase gene and the activity of the target protein, with subsequent steps aimed at detecting the expression of the thaumatin gene and examining the plants' responses under stress conditions.The conducted experiments to create plants exhibiting enhanced resistance to abiotic and biotic stresses yielded potentially successful outcomes. For the first time, the simultaneous insertion of the taumatine II gene into tobacco was studied, which did not interfere with the expression and activity of the desaturase enzyme associated with the desA gene. Current efforts are focused on testing and confirming the expression systems for the thaumatin gene, with further studies planned to assess the resistance of the double transformants to lowtemperature stress and pathogenic threats.Funding. The research was funded by a grant National Academy of Science of Ukraine to research laboratories/groups of young scientists to conduct research in priority areas of science and technology development (UkrISTEI grant no. 0120U100130).