First Report of Root-Knot Disease Caused by <i>Meloidogyne hapla</i> on <i>Knoxia roxburghii</i> in Yunnan, China

Knoxia roxburghii (Spreng) M.A. Rau (“Hong Daji”), a perennial Rubiaceae herb and traditional Chinese medicine for cancers, carbuncles, and ascites, is widely distributed in southern China and Southeast Asia (Chen et al. 2022; Zhang et al. 2023). For the purpose of safeguarding the sustainable utilization of the wild resources, it is cultivated in Yunnan, Guangxi, and Guangdong of China. In April 2025, root-knot nematode disease was observed on K. roxburghii in Anning, Yunnan (24.9894° N, 102.4319° E), China. K. roxburghii plants infected with root knot nematodes formed root knots on both tap roots and fibrous roots, which could lead to root necrosis in severe cases. In addition, the mean weight of root knot on the tap roots accounted for 33.71 % of the total root weight per plant (n=20). Rhizosphere soil samples were collected at a depth of 15 cm, and second-stage juveniles (J2s) of nematodes were isolated using the Baermann funnel method as described by Cesarz et al. (2019). Nematode J2s density within soil samples was 24.25 ± 10.30 /100 g soil (n=3). Egg masses and females were isolated from diseased roots. J2s were obtained by incubating egg masses at 25 °C. Morphological analysis showed characteristics consistent with Meloidogyne hapla described by Whitehead (1968) and Wu (2023). For J2s (n=20), body length= 462.59 ± 48.19 μm, body width 23.04 ± 1.63 μm, tail length= 48.42 ± 8.77 μm, stylet length= 14.03 ± 1.18 μm, distance from dorsal esophageal gland opening to the stylet knot (DGO)= 3.90 ± 0.68 μm; for females (n=20), pear-shaped, body length= 574.55 ± 87.38 μm, maximum body width= 379.93 ± 62.06 μm, stylet length= 11.36 ± 1.46 μm, DGO= 3.02 ± 0.39 μm, stylet median bulb width (MBW)= 24.54 ± 6.09 μm, the perineum morphology is low dorsal arch round, with a typical inferior protrusion near the anus. Molecular identification was performed via amplifying 28S rDNA D2/D3 and ITS region by primers D2A/D3B (ACAAGTACCGTGAGGAAAGTTG/TCGGAAGGAACCAGCTACTA) and TW81/AB28 (GTTTCCGTAGGTGAACCTGC/ATATGCTTAAGTTCAGCGGGT), respectively (Subbotin et al. 2001; 2006). D2/D3 and ITS sequencing (GenBank accessions PV747744 and PV746187) revealed 99.78 - 100 % similarity to M. hapla sequences (OQ269680.1 and JX465560.1). Phylogenetic trees (MEGA11, neighbor-joining method) clustered the nemaode with M. hapla. Inoculation tests were performed in a greenhouse, with the average temperature maintained at 25 ℃ and natural, unshaded lighting. Approximately 1000 J2s per plant were inoculated onto 30 healthy potted K. roxburghii plants, while 30 potted control plants without nematodes. After 90 days, typical gall symptoms were observed on inoculated plants, whereas no symptoms were detected in the control group. Molecular reconfirmation confirmed M. hapla. The gall index (GI) was assessed using the number of galls rated on a 0 to 5 scale (Brito et al. 2020). The inoculated K. roxburghii plants had an average of GI 1.84 ± 0.94, eggs/g root 39.13 ± 17.27, egg masses/root 14.00 ± 5.62, and a reproduction factor (RF) 4.07 ± 1.64. To our knowledge, this is the first report of M. hapla infecting K. roxburghii in Yunnan, China. This study not only lays a scientific foundation for early disease warning, but also holds significant scientific significance and application value for ensuring the safe production of K. roxburghii.