Urbanus (Urbanoides) dolus Zhang & Cong & Shen & Song & Grishin 2025, new species

Urbanus (Urbanoides) dolus Grishin, new species http://zoobank.org/ 89F465B0-F9CE-4BB0-A902-257402570AD3 (Figs. 11 part, 12b, 13) Definition and diagnosis. In an attempt to find additional specimens of the recently described Urbanus (Urbanoides) elma Grishin, 2025 (type locality in Venezuela: Mérida) (Fig. 12c), currently known only from the holotype (female) and the paratype (male), we have sequenced a female from Tolima, Colombia. This specimen, identified and illustrated (genitalia only) by Steinhauser (1981) as Urbanus (Urbanoides) elmina Evans, 1952 (type locality in Ecuador: Rio Pastaza), is instead sister to Urbanus (Urbanoides) viridis Freeman, 1970 (type locality in Mexico: Veracruz, holotype sequenced as NVG-15104A04) in the nuclear genome tree (Urbanus (Urbanoides) esta Evans, 1952 (type locality in Brazil: São Paulo) is sister to them both), but is genetically differentiated at the species level (Fig. 11). Therefore, this female represents a new species. Interestingly, COI barcodes do not differ among the three species: the new one, U. viridis, and U. esta, probably due to introgression. The new species keys to U. elmina in Evans (1952) (C.13.9) and Steinhauser (1981) and was included by them in that taxon, but differs from it and U. elma by the following combination of characters in females: the ventral hindwing with a narrower postdiscal brown band; four smaller, darker, and better separated from each other spots in the basal half; a stronger contrast between the marginal area of nearly ground color from the apex to the vein CuA 1 and the darker area from the vein CuA 1 through the tail; whiter (less yellow) semi-hyaline forewing spots; and a slightly rounder hindwing. The new species is more similar to its closer relatives U. viridis or U. esta in having a contrasting paler ventral hindwing margin from the apex to the vein CuA 1; better separated from each other four spots in the basal half of the ventral hindwing; whiter semi-hyaline forewing spots; and female genitalia with a moderately sclerotized lamella antevaginalis that has a well-developed central notch (Fig. 13); but differs from them by a more washed-out appearance of the ventral hindwing with paler bands and spots (but not as pale as in U. elmina and U. elma), the postdiscal band uniformly brown without paler veins crossing it, and smaller spots in the basal half. The lamella postvaginalis has a deeper, U-shaped central notch of more than a third of its length and its lobes have a convex distal margin on both sides. To facilitate comparison, we illustrate a female of its sister species, U. viridis (NVG-19013F10, Mexico: Tamaulipas, Sierra Cucharas, nr. rock quarry, eclosed on 3-Dec-1974, reared on Desmodium neomexicanum A. Gray, R. O. Kendall & C. A. Kendall leg. [TAMU]) (Fig. 12a). Due to the cryptic nature of this species, unrecognized males, and unexplored individual variation, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly330.11.2:G174A, aly330.11.2:G510C, aly 2828.8.1:T84C, aly 2828.8.1:A291T, aly1038. 10.3:C612T, aly2976.14.2:C150C (not T), aly6841.3.3:A116A (not G), aly6841.3.3:A499A (not G), aly6841. 3.3:A867A (not T), aly1651.36.1:A1324A (not G). In the COI barcode, this species does not differ from either U. viridis or U. esta. Barcode sequence of the holotype. Sample NVG- 24111A06, GenBank PV892287, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGATTAGTTGGTACTTCATTAAGATTAC TTATTCGAACTGAATTAGGAACCCCTGGATCTTTAATTGGAGATGATCAAATTTATAAT ACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAAT TGGAGGATTTGGTAATTGATTAGTTCCCCTAATAATAGGAGCCCCTGACATAGCTTTCC CCCGTATAAATAATATAAGATTTTGATTATTACCCCCTTCTTTAACTTTATTAATTTCA AGAAGAATCGTTGAAAATGGTGCTGGTACTGGATGAACAGTTTATCCCCCTCTTTCATC TAATATTGCCCATCAAGGAGCTTCTGTTGACTTAGCAATTTTTTCCCTACATCTTGCTG GTATTTCATCTATTCTTGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATT AATAATTTATCTTTTGATCAAATACCTTTATTTGTATGAGCTGTAGGAATTACAGCATT ATTATTATTATTATCTTTACCTGTTTTAGCGGGAGCTATCACTATATTATTAACTGATC GAAATTTAAATACCTCCTTTTTTGACCCAGCAGGAGGAGGAGATCCTATTTTATATCAA CATTTATTT Type material. Holotype: ♀ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA (MGCL), illustrated in Fig. 12b (genitalia Fig. 13), bears the following five rectangular labels (2 nd handwritten, others printed with handwritten text shown in italics), four white: [COLOMBIA: TOLIMA | La Aurora, R. Cambrin | 1300 m.; 17.XI.1974 | S. & L. Steinhauser], [GENIT. PREP. | SRS-406], [A. C. Allyn | Acc. 1975-17], [DNA sample ID: | NVG- 24111A06 | c/o Nick V. Grishin], and one red [HOLOTYPE ♀ | Urbanus (Urbanoides) dolus Grishin]. Genitalia of the holotype, misidentified as Urbanus elmina, were illustrated in fig. 58 by Steinhauser (1981). Type locality. Colombia: Tolima, La Aurora, Río Cambrín, elevation 1300 m. Etymology. In Greek, δόλος (dólos) means deceit, treachery, guile, or craftiness; the same meaning carries to Latin dolus. The name is given for the deceitful appearance of this species, which is sister to U. viridis, but in the ventral hindwing pattern looks more similar to U. elmina or U. elma and was identified as U. elmina by Steinhauser (1981). The name is an adjective. Distribution. Currently known only from the holotype collected on the western slopes of the eastern Andes of Colombia.