Thespieus grandosul Zhang & Cong & Shen & Song & Grishin 2025, new species

Thespieus grandosul Grishin, new species http://zoobank.org/ 8E47C852-82A8-4841-B2E0-85DE20E52512 (Figs. 22 part, 23) Definition and diagnosis. Genomic analysis reveals that a specimen from Rio Grande do Sul, Brazil, is sister in the nuclear genome (autosomes) tree to the sympatric Thespieus ethemides (Burmeister, 1878) (type locality in Argentina: Corrientes), but is genetically differentiated from it at the species level (Fig. 22a); e.g., their COI barcodes differ by 3.8% (25 bp), and, therefore, represents a new species. In the Z chromosome and the mitochondrial genome trees (Fig. 22b, c), this new species is sister to Thespieus dalman (Latreille, [1824]) (type locality in Brazil) and is phenotypically more similar to it, thus keying to T. dalman (O.7.4) in Evans (1955), but differs from both T. dalman and T. ethemides by larger hyaline spots, e.g., on the hindwing, the spot in the cell CuA 1 -CuA 2 is longer than wide and starts from the base of the vein CuA 1, and the base of the cell CuA 1 -CuA 2 (basad of the spot) is paler brown, not nearly black as the rectangle distad of the spot. Due to its cryptic nature and unexplored individual variation, this species is best identified by DNA, with diagnostic base pairs in the nuclear genome: aly159.13.2:G66A, aly1019. 14.13:G165A, aly383.29.15:T210C, aly536.75.1:C2445T, aly3507.14.4:C1098T, aly3446.4.1:A21A (not T), aly638.29.3:G120G (not T), aly994.6.3:C132C (not T), aly 2275.10.7:T120T (not C), aly525.73.10: G153G (not A); and the COI barcode: T46T, C59C, T460T, T514C, A628G. Barcode sequence of the holotype. Sample NVG-23109G03, GenBank PV892292, 658 base pairs: AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATATTAGGAACTTCATTAAGATTACTAATTCGTACAGAATTAGGTAATCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTCGGAAATTGATTAATCCCATTAATATTAGGAGCCCCTGATATAGCTTTTCCTCGAA TAAATAATATAAGATTTTGAATATTACCCCCCTCTTTAACATTATTAATTTCAAGAAGAATTGTAGAAAATGGTGCAGGAACTGGATGAACAGTTTATCCACCTTTATCTTCTAATATTGC TCATCAAGGATCTTCAGTAGATTTAGCAATCTTTTCTCTTCATTTAGCTGGAATTTCATCTATTTTAGGAGCTATTAATTTTATTACAACAATTATTAACATACGAATTAAAAATTTATCA TTTGATCAAATACCTTTATTTGTATGATCCGTAGGTATTACAGCATTATTATTACTTTTATCTTTACCTGTATTAGCAGGAGCTATTACTATATTATTAACTGATCGAAATTTAAATACTT CTTTTTTTGATCCTGCAGGAGGGGGAGATCCAATTTTATATCAACATTTATTT Type material. Holotype: ♂ deposited in the Carnegie Museum of Natural History, Pittsburgh, PA, USA (CMNH), illustrated in Fig. 23, bears the following five printed rectangular labels, four white: [Rio Grande | do Sul], [692.], [Lindsay Collection | C. M. Acc. No. 8584], [DNA sample ID: | NVG-23109G03 | c/o Nick V. Grishin], and one red [HOLOTYPE ♂ | Thespieus | grandosul Grishin]. Type locality. Brazil: Rio Grande do Sul. Etymology. The name is given for the type locality, [Rio] Gran [de] + do + Sul, and is treated as a noun in apposition. Distribution. Currently known only from the holotype collected in Rio Grande do Sul, Brazil.