Anacharis martinae Vogel, Forshage & Peters 2024, sp. nov.

Anacharis martinae Vogel, Forshage & Peters sp. nov. Figs 2 F, 3 C, 12 A – E Diagnosis (n = 18). Belongs to the eucharioides species group. Medium sized species (2.6–3.3, mean 2.9 mm, similar to A. eucharioides, A. petiolata and A. typica). Different from A. petiolata and A. typica in having a centrally carinate mesoscutellum (Fig. 12 D, centrally smooth in A. petiolata and A. typica). Different from A. eucharioides by having oblique carinae on the lateromedial area of the pronotum (Fig. 12 B). This character is shared with A. belizini, which is an Indomalayan species described from Thailand. Anacharis martinae differs from A. belizini by having a larger glabrous area on the clypeus medioventrally (largely pubescent in A. belizini) (Fig. 12 C) and a brown to dark-brown metasoma (black in A. belizini) (Fig. 12 A). WIPs: The band pattern of the fore wings reaching along about half the length of the non-sclerotised vein M (Fig. 2 C, reaching along at least 2 / 3 the length of the non-sclerotised vein M in all other species, including those of the immunis species group). The apical spot of the hind wing fills almost the entire apical area (Fig. 2 C, filling about half the apical area in other species of the eucharioides species group). Description. Both sexes. Size. Body: ♀ 2.6–3.2 (3.2) mm, ♂ 2.3–2.9 mm. Antennae: ♀ 1.7–2.3 (2.1) mm, ♂ 2–2.3 mm. Fore wing: 2.1–2.8 (2.5) mm Colour. Body black to reddish-brown (Fig. 12 A); base of scape usually (Fig. 12 A, C), head always (Fig. 12 A, C), base of mandibles usually (Fig. 12 C), mesosoma usually (Fig. 12 A, B, D, E), coxa to a varying degree (Fig. 12 A), hind-trochanter usually basally, and petiole usually black (Fig. 12 A); scape usally apically (Fig. 12 C), rest of antennae (Fig. 12 A), tegulae (Fig. 12 B, D) and metasoma brown (Fig. 12 A); mandibles & palps (Fig. 12 C) and rest of legs (Fig. 12 A) testaceous. Head. Roundish-trapezoid in frontal view, genae gently kinked, in an angle <90 ° to the vertical axis of the face (Fig. 12 C); lower face with thick silvery hairs, densely punctured (Fig. 12 C); clypeal margin bilobed, somewhat flanged upwards, clypeus otherwise convex, medioventrally smooth, otherwise punctate (Fig. 12 C); malar area with coriaceous texture, reaching from ventral eye margin along entire stretch of mandibular base (Fig. 18 B), anteroventral corner of mandibular base sometimes smooth; genae smooth around eye, with increasingly dense punctation and regular setae towards the hind margin; upper face with somewhat thinner setae, punctured, with usually shallow median dent; space between toruli sometimes transversally striolate, intertorular distance: torulus to eye distance 1.4–2.0 (1.9); eyes with scattered setae, extent varying (Fig. 12 C); POL: OOL: LOL: OD 2.4–2.8 (2.6): 1.2–2.1 (1.3): 1–1.4 (1.2): 1, POL: petiole length 0.45–0.75 (0.59); vertex pubescent between lateral ocellus and compound eye, small glabrous area anterior of median ocellus reaching until median dent of upper face; head in dorsal view 1.9–2.5 (2.3) times wider than long, laterally longer than medially; vertex and occiput sometimes with shallow and smooth median furrow, occiput with transverse striae (Fig. 12 D), interrupted medially by furrow if present. Antennae. ♀ formula: 1.9–2.3 (2.1): 1: 2.1–2.8 (2.5): 1.6–2.1 (2.0): 1.4–2 (1.8): 1.3–1.9 (1.8): 1.3–1.7 (1.6): 1.3–1.6 (1.6): 1.3–1.7 (1.5): 1.3–1.6 (1.4): 1.1–1.5 (1.4): 1.1–1.5 (1.4): 2.1–2.5 (2.3) ♂ formula: 1.6–2.7: 1: 2 – 2.9: 1.6 – 2.5: 1.4 – 2.3: 1.3 – 2: 1.3 – 1.9: 1.3 – 2.1: 1.3 – 2: 1.3 – 2: 1.1 – 2: 1.1 – 2: 1.3 – 2 Mesosoma. Mesosoma 1.3–1.4 (1.4) times longer than high (Fig. 12 B); pronotal plate variable in sculpture, usually smooth with some few radial carinae; pronotum laterally setose, with longitudinal carinae along entire stretch reaching the posterior margin (Fig. 12 B), sometimes somewhat branching; mesopleuron without coriaceous texture, rugulose anteroventrally, setose anteroventrally and along ventral margin, otherwise glabrous (Fig. 12 B); mesopleural line merging with posteroventral hypocoxal furrow, ventral margin somewhat continuous, dorsally marked by influent striae (Fig. 12 B); mesopleural triangle separated from mesopleuron by carina that fades before reaching the posterior subalar pit, posterodorsally smooth and shiny; axillulae well delimited (Fig. 12 B), inside setose and longitudinally striate; mesoscutum 1.0–1.2 (1.1) times wider than long and 1.3–1.5 (1.4) times longer than the mesoscutellum (Fig. 12 D); notauli distinct, sometimes deep, with weak or strong transversal carination inside that is less dense than in A. eucharioides, usually surrounded by weak to strong wrinkles (Fig. 12 D); median lobe of mesoscutum setose, gradually weakening towards posterior end (Fig. 12 D), lateral lobes denser setose along outer margins than along inner margins; mesoscutellar foveae sometimes each delimited by a circumfoveal carina (Fig. 12 D), which is sometimes not fusing with median carina; median carina sometimes extending over entire dorsal surface of mesoscutellum (Fig. 12 D), sometimes interrupted, rarely completely absent, usually accompanied by lateral carinae that are less distinct but are not prone to disappear among general reticulate inside (as in A. eucharioides); posterior surface of mesoscutellum medially broadly raised (Fig. 12 E), evenly setose, with one, two or more (sub-) median longitudinal carinae (Fig. 12 E), rarely branching, laterally smooth to reticulate; dorsal axillular area laterally rugose to striate (Fig. 12 D – E); sculpture of propodeum variable; nuchal collar usually with a narrow tooth dorsomedially (Figs 6 C, 12 E). Wings. Marginal cell of fore wing 2.5–2.8 (2.6) times longer than wide (Fig. 2 C). WIPs (Fig. 2 C): Purple band pattern of fore wing reaching along about half the length of vein M. Apical spot of hind wing large, filling almost entire apical area. Metasoma. 0.9–1.2 (1.2) times longer than rest of body (Fig. 12 A); gaster 2.1–2.4 (2.4) times longer than petiole (Fig. 12 A); petiole 1.0–1.6 (1.4) times longer than hind coxa (Fig. 12 A); metasomal tergite 2 (T 2) with 0–4 (2) lateral setae on each side, with irregular punctures, T 3-4 with narrow bands of punctures, dorsally usually interrupted, T 5 with broad band of punctures, decreasing in width on T 6-7, T 7 with few setae along the band and more setae in posterior half than in the anterior half. Male genitalia. Parameral plate submedially widened, basoventral margin rounded, without tooth. Males. Flagellomeres dorsoventrally bicoloured yellow-dark brown, gaster shorter than in females. T 7 in males almost entirely punctured except medially, long setae across surface, except on smooth area. Variation. The specimens from the Bavarian Forest National Park (BC- ZSM -HYM-27596 -F 10 & BC- ZSM -HYM-27596 -F 09) are in colouration similar to the holotype (Fig. 12), but more distinct, i. e. the head is distinctly darker than the rest of the body. They are also smaller than the average. ZFMK -TIS-2640713 has a strong sculpture on its pronotal plate, whilst other specimens are rather smooth and of weaker sculpture. ZFMK -TIS-2640791 has a completely smooth dorsal surface of the meso-scutellum but fits otherwise well within the species morphologically. CO 1 barcode. n = 18. Maximum intraspecific distance = 2.3 %. Minimum distance to closest species (A. eucharioides) = 7.9 %. CO 1 barcode consensus sequence: AATTTTATACTTTATTTTAGGTATTTGATCAGGAATAATAGGATCAAGATTAAGAATAATTATTCGAAT AGAATTAGGAACCCCATCTCAATTAATCATAAATGATCAAATTTATAACTCAATTGTAACTGCTCATGCA TTTATTATAATTTTTTTTATAGTAATACCAATTATAGTAGGAGGATTTGGAAATTATCTGGTTCCTCTAA TACTAATTTCTCCTGATATAGCCTTCCCACGATTAAATAATTTAAGATTTTGATTTTTAATCCCATCCCT ATTTTTAATAACAATAAATTTATTTATTGATCAAGGAGCTGGTACAGGATGAACTGTATACCCTCCACTA TCCTCCTTAACGGGTCATCCATCAATATCAGTAGATTTAGTTATTTATTCTCTTCATTTAAGAGGAATTT CTTCAATTCTTGGTTCAATTAATTTTATTGTAACAATTTTAAATATACGAATAAACTCAATAACAATAGA TAAAATTTCATTATTCATTTGATCTATTTTTTTAACAACTATTTTACTATTATTATCATTACCTGTATTA GCTGGAGGTTTAACAATATTACTTTTTGATCGAAACTTAAATACATCATTTTTTGATCCTACAGGAGGAG GAGACCCAATTTTATATCAACATTTATTT Type material. Holotype. Germany • ♀; Hesse, Waldeck-Frankenberg, National park Kellerwald-Edersee, Banfehaus, old floodplain of the Banfe; 51.167 ° N, 8.9749 ° E; ca 270 m a. s. l.; 22 Jul. - 5 Aug. 2021; GBOL III leg.; Malaise trap (Krefeld version); ZFMK -TIS-2640787. Paratypes. Germany • 2 ♂♂; same collection data as for holotype; ZFMK -TIS-2640788, ZFMK -TIS-2640791. • 1 ♂; Bavaria, Bavarian Forest National Park; 48.937 ° N, 13.42 ° E; ca 830 m a. s. l.; 1 Jun. 2013; BC- ZSM -HYM-27764 -H 01 (ZSM). • 1 ♀, 1 ♂; Bavaria, Bavarian Forest National Park; 49.099 ° N, 13.233 ° E; ca 710 m a. s. l.; 1 Jun. 2013; female - BC- ZSM -HYM-27596 -F 10 (ZSM); male - BC- ZSM -HYM-27596 -F 09 (ZSM). • 1 ♂; Bavaria, Garmisch-Partenkirchen, Zugspitze, mountain; 47.4062 ° N, 11.0095 ° E; ca 1970 m a. s. l.; 20 Jun. - 5 Jul. 2018; Doczkal, D., Voith, J. leg.; Malaise trap; ZFMK -TIS-2637892 (NHMUK). • 1 ♂; Hesse, Gießen, Hohberg, Großen-Buseck; 50.6196 ° N, 8.7844 ° E; ca 300 m a. s. l.; 17 Jun. 2021; GBOL III leg.; sweep net; ZFMK -TIS-2629493. • 1 ♂; Hesse, Rheingau-Taunus, Lorch am Rhein, above Nollig castle; 50.0495 ° N, 7.7966 ° E; ca 250 m a. s. l.; 17–25 Jun. 2015; Niehuis, Oliver leg.; Malaise trap; MF 3; ZFMK -TIS-2628231. • 1 ♀, 2 ♂♂; Hesse, Waldeck-Frankenberg, National park Kellerwald-Edersee, Maierwiesen; 51.1555 ° N, 9.0015 ° E; ca 370 m a. s. l.; 22 Jun. - 8 Jul. 2021; GBOL III leg.; Malaise trap (Krefeld version); female - ZFMK -TIS-2640809 (NHRS); males - ZFMK -TIS-2640804, ZFMK -TIS-2640805 (NHRS). • 1 ♀; Hesse, Waldeck-Frankenberg, NP Kellerwald-Edersee, „ Banfe-Haus “; 51.167 ° N, 8.9749 ° E; ca 270 m a. s. l.; 7–21 Jul. 2022; GBOL III leg.; Malaise trap; ZFMK -TIS-2640770. • 1 ♀; Hesse, Waldeck-Frankenberg, NP Kellerwald-Edersee, „ Große Küche “; 51.1564 ° N, 8.9879 ° E; ca 320 m a. s. l.; 19 Aug. - 2 Sep. 2021; GBOL III leg.; Malaise trap; ZFMK -TIS