Anacharis eucharioides

Anacharis eucharioides (Dalman, 1818) Figs 2 G, 3 F, 10 A – E Cynips eucharioides Dalman, 1818: 78 - type lost. Anacharis tinctus Walker, 1835: 520 - lectotype (NHMUK) ♀, synonymised in Fergusson (1968), photographs examined. Megapelmus spheciformis Hartig, 1840: 202 (removed from synonymy with A. typica) - lectotype (ZSM) ♂, first synonymised in Reinhard (1860), examined. Anacharis fergussoni Mata-Casanova & Pujade-Villar, 2018: 16 syn. nov. - holotype (CNC) ♀, photographs examined. Anacharis eucharoides auct., common misspelling. Diagnosis (n = 290). Most common species within the eucharioides species group. Medium sized body (2.7–3.4, mean 3.1 mm, similar to A. typica, A. petiolata & A. martinae). Differing from A. typica and A. petiolata by having a mesoscutellum with a median carina present, which is typically interrupted centrally by reticulation (largely smooth and even in A. petiolata and A. typica) (Fig. 10 D). Differing from A. martinae by having the lateromedial area of the pronotum smooth to rugose (Fig. 10 B, with longitudinal carinae that are a continuation of the ventral carinae in A. martinae). Unique in usually having the mesoscutum glabrous to more sparsely pubescent than the rest of the mesoscutum (Fig. 10 D, more evenly pubescent in all other species). The male genitalia of A. eucharioides (Fig. 3 F) are unique in not being significantly widened basally or medially, i. e. being more parallel-sided (basally or medially widened in all other species Fig. 3 C – E). CO 1 barcode. n = 289. Maximum intraspecific distance = 2.5 %. Minimum distance to closest species (A. petiolata) = 2.9 %. CO 1 barcode consensus sequence: AATTTTATACTTTATTTTAGGTATTTGATCTGGAATAATAGGATCAAGATTAAGAATAATTATTCGAAT AGAATTAGGAACCCCATCTCAATTAATCATAAATGATCAAATTTATAATTCAATTGTAACTGCTCATGCA TTTATTATAATTTTCTTTATAGTTATACCTATTATAGTTGGAGGATTTGGGAATTATTTAGTACCTTTAA TATTAATTTCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGATTTTTAATCCCTTCCTT ATTTTTAATAACAATTAATTTATTTATTGATCAAGGAGCAGGAACAGGATGAACTGTTTACCCTCCATTA TCCTCCCTAACAGGTCATCCATCTATATCAGTAGATTTAGTTATTTACTCATTACATTTAAGTGGAATTT CATCAATTCTTGGATCAATTAATTTTATTGTAACCATTTTAAATATACGAATAACTTCTATATCTATAGA CAAAATTTCATTATTTATTTGATCTATTTTTCTAACTACAATTTTACTATTATTATCTTTACCCGTACTA GCAGGAGGATTAACGATACTATTATTTGATCGAAATTTAAATACATCTTTTTTTGACCCCACAGGAGGAG GAGACCCTATTCTTTATCAACATTTATTT Type material. Lectotype of Anacharis tinctus Walker, 1835, designated by Fergusson (1986) 81 86 [on backside of mounting board] Type B. M. 1981. Under tincta LECTO-TYPE LECTOTYPE Anacharis tincta Walker det. N. D. M. Fergusson, 1981 B. M. TYPE HYM 7.162 [QR code] NHMUK 012858912 [for images, see https://data.nhm.ac.uk/dataset/56e711e6-c847-4f99-915a-6894bb5c5dea/resource/05ff2255-c38a-40c9-b657-4ccb55ab2feb/record/10470209] Lectotype of Megapelmus spheciformis Hartig, 1840, designated by Weld (1952) Weld 1931 Megapelmus spheciformis [handwritten, probably by Hartig himself] LECTOTYPE of MEGAPELMUS spheciformis det. N. D. M. Fergusson, 1982 Anacharis eucharoides Dal. det. N. D. M. Fergusson, 1982 Anacharis eucharioides (Dalman, 1818) ♂ Det. Jonathan Vogel 2024 Holotype of Anacharis fergussoni Mata-Casanova & Pujade-Villar, 2018 Germany • 1 ♀; Rhineland Palatinate, Mainz-Bingen, Ingelheim am Rhein, orchard; 1–30 Sep. 1968; I. Sreffan leg.; Malaise trap. [for images, see https://www.cnc.agr.gc.ca/taxonomy/Specimen.php?id=3274133] Other material examined. DNA barcode voucher s. Belgium • 1 ♀; East Flanders, Assenede, Isabellepolder, Agricultural land with Partridge mix; 51.266 ° N, 3.71 ° E; ca 0 m a. s. l.; 12–19 Jun. 2019; UGent leg.; yellow pan trap; ZFMK -TIS-2640673. • 2 ♂♂; West Flanders, Ypres, De Triangel, Urban park (bushes); 50.8418 ° N, 2.8838 ° E; ca 20 m a. s. l.; 30 Apr. - 14 May 2022; Verheyde, Fons leg.; Malaise trap; ZFMK -TIS-2640843, ZFMK -TIS-2640844. • 3 ♀♀, 9 ♂♂; same collection data as for preceding 14–28 May 2022; females - ZFMK -TIS-2640845, ZFMK -TIS-2640846, ZFMK -TIS-2640847, ZFMK -TIS-2640859, ZFMK -TIS-2640860, ZFMK -TIS-2640861; males - ZFMK -TIS-2640848, ZFMK -TIS-2640849, ZFMK -TIS-2640850, ZFMK -TIS-2640851, ZFMK -TIS-2640852, ZFMK -TIS-2640853, ZFMK -TIS-2640854, ZFMK -TIS-2640855, ZFMK -TIS-2640856, ZFMK -TIS-2640862, ZFMK -TIS-2640863. • 1 ♂; same collection data as for preceding 2–23 Jul. 2022; ZFMK -TIS-2640868. • 3 ♀♀, 2 ♂♂; West Flanders, Ypres, De Triangel, Urban park (pool vegetation); 50.8427 ° N, 2.884 ° E; ca 20 m a. s. l.; 14–28 May 2022; Verheyde, Fons leg.; Malaise trap; females - ZFMK -TIS-2640859, ZFMK -TIS-2640860, ZFMK -TIS-2640861; males - ZFMK -TIS-2640862, ZFMK -TIS-2640863. Germany • 1 ♂; Baden-Württemberg, Biberach, Altheim; 48.1399 ° N, 9.4491 ° E; ca 540 m a. s. l.; 6–19 Aug. 2013; Schmalfuß, H. leg.; Malaise trap; ZFMK -TIS-2629512. • 2 ♀♀, 8 ♂♂; Baden-Württemberg, Karlsruhe, Malsch, Hansjakobstraße, garden; 48.8835 ° N, 8.3197 ° E; ca 120 m a. s. l.; 26 Apr. - 10 May 2020; Dieter Doczkal leg.; Malaise trap; females - ZFMK -TIS-2640753, ZFMK -TIS-2640754; males - ZFMK -TIS-2640745, ZFMK -TIS-2640746, ZFMK -TIS-2640747, ZFMK -TIS-2640748, ZFMK -TIS-2640749, ZFMK -TIS-2640750, ZFMK -TIS-2640751, ZFMK -TIS-2640752. • 1 ♂; same collection data as for preceding 25 Oct. - 8 Nov. 2020; ZFMK -TIS-2640726. • 11 ♀♀, 1 ♂; Baden-Württemberg, Stuttgart, Espan; 49.6167 ° N, 9.2667 ° E; ca 280 m a. s. l.; 28 Jul. - 28 Aug. 2014; Woog, F. leg.; females - ZFMK -TIS-2640775, ZFMK -TIS-2640776, ZFMK -TIS-2640777, ZFMK -TIS-2640778, ZFMK -TIS-2640779, ZFMK -TIS-2640780, ZFMK -TIS-2640781, ZFMK -TIS-2640782, ZFMK -TIS-2640783, ZFMK -TIS-2640784, ZFMK -TIS-2640785; male - ZFMK -TIS-2640786. • 1 ♀, 10 ♂♂; Baden-Württemberg, Tübingen, Hirschau, Oberes Tal, orchard; 48.505 ° N, 8.993 ° E; ca 390 m a. s. l.; 29 Apr. - 13 May 2014; Kothe, T., Engelhardt, M., Bartsch, D. leg.; Malaise trap; female - ZFMK -TIS-2629263; males - ZFMK -TIS-2629200, ZFMK -TIS-2629201, ZFMK -TIS-2629202, ZFMK -TIS-2629203, ZFMK -TIS-2629204, ZFMK -TIS-2629218, ZFMK -TIS-2629540, ZFMK -TIS-2629541, ZFMK -TIS-2629542, ZFMK -TIS-2640774. • 1 ♂; Baden-Württemberg, Tübingen, Hirschau, Oberes Tal, orchard; 48.505 ° N, 8.9935 ° E; ca 370 m a. s. l.; 23 May- 6 Jun. 2014; Kothe, T., Engelhardt, M., Bartsch, D. leg.; Malaise trap; ZFMK -TIS-2628235. • 3 ♀♀; Baden-Württemberg, Tübingen, Hirschau, Wiesenweingärten; 48.5043 ° N, 8.9956 ° E; ca 380 m a. s. l.; 17–31 Jul. 2014; Kothe, T., Engeldhardt, M., König, C. leg.; Malaise trap; ZFMK -TIS-2629238, ZFMK -TIS-2629267, ZFMK -TIS-2629268. • 1 ♀; Baden-Württemberg, Tübingen, Steinenberg; 48.5306 ° N, 9.0312 ° E; ca 470 m a. s. l.; 31 Jul. - 14 Aug. 2014; Kothe, T., Engeldhardt, M., König, C. leg.; Malaise trap; ZFMK -TIS-2629237. • 4 ♀♀; Baden-Württemberg, Tübingen, Steinenberg; 48.5313 ° N, 9.03 ° E; ca 490 m a. s. l.; 4–17 Jul. 2014; Kothe, T., Engelhardt, M., König, Ch. leg.; ZFMK -TIS-2629504, ZFMK -TIS-2629505, ZFMK -TIS-2629506, ZFMK -TIS-2629507. • 1 ♀, 1 ♂; Baden-Württemberg, Tübingen, Steinenbergturm; 48.531 ° N, 9.03 ° E; ca 490 m a. s. l.; 14–29 Aug. 2014; Kothe, T., Engeldhardt, M., König, C. leg.; Malaise trap; female - ZFMK -TIS-2629236; male - ZFMK -TIS-2629219. • 1 ♂; Baden-Württemberg, Tübingen, Wurmlingen, Gengental, orchard; 48.5131 ° N, 8.9923 ° E; ca 370 m a. s. l.; 13–23 May 2014; Kothe, T., Engeldhardt, M., König, C. leg.; Malaise trap; ZFMK -TIS-2640681. • 1 ♀, 1 ♂; Bavaria, Main-Spessart, Lohr, Nat. res. Romberg, pasture woodland; 49.9864 ° N, 9.5896 ° E; ca 190 m a. s. l.; 9 Jun. - 6 Jul. 2018; Dieter Doczkal leg.; Malaise trap; female - ZFMK -TIS-2640717; male - ZFMK -TIS-2640716. • 1 ♂; Bavaria, Rhön-Grabfeld, Fladungen, Nat. res. Schwarzes Moor, Karpatenbirkenwald; 50.5117 ° N, 10.071 ° E; ca 780 m a. s. l.; 26 Jun. - 18 Jul. 2017; Dieter Doczkal leg.; Malaise trap; ZFMK -TIS-2629538. • 2 ♀♀; Hesse, Gießen, Nat. res. Holzwäldchen bei Gleiberg; 50.605 ° N, 8.6316 ° E; ca 190 m a. s. l.; 14 Jun. 2021; GBOL III leg.; sweep net; ZFMK -TIS-2629494, ZFMK -TIS-2629495. • 1 ♀; Hesse, Kassel, Nat. res., „ Fuldaschleuse Wolfsanger “, meadow along Fulda river with Salix and Phragmites; 51.329 ° N, 9.5565 ° E; ca 130 m a. s. l.; 13–27 Oct. 2020; GBOL III leg.; sweep net; Loc. 1; ZFMK -TIS-2628230. • 3 ♀♀; Hesse, Rheingau-Taunus, Lorch am Rhein, above Nollig castle; 50.0491 ° N, 7.7978 ° E; ca 240 m a. s. l.; 27 May- 7 Jun. 2013; Niehuis, Oliver leg.; Malaise trap; MF 1; ZFMK -TIS-2629498, ZFMK -TIS-2629499, ZFMK -TIS-2629500. • 1 ♀, 1 ♂; same collection data as for preceding 17–25 Jun. 2015; MF 4; female - ZFMK -TIS-2629248; male - ZFMK -TIS-2629214. • 8 ♂♂; same collection data as for preceding 15–21 Jul. 2013; MF 1; ZFMK -TIS-2629227, ZFMK -TIS-2629240, ZFMK -TIS-2629241, ZFMK -TIS-2629521, ZFMK -TIS-2629522, ZFMK -TIS-2629523, ZFMK -TIS-2629524, ZFMK -TIS-2629525. • 20 ♂♂; same collection data as for preceding 21–27 Jul. 2013; ZFMK -TIS-2629225, ZFMK -TIS-2629226, ZFMK -TIS-2629553, ZFMK -TIS-2629554, ZFMK -TIS-2629555, ZFMK -TIS-2629556, ZFMK -TIS-2629557, ZFMK -TIS-2629558, ZFMK -TIS-2629559, ZFMK -TIS-2629560, ZFMK -TIS-2629576, ZFMK -TIS-2629577, ZFMK -TIS-2640820, ZFMK -TIS-2640821, ZFMK -TIS-2640822, ZFMK -TIS-2640823, ZFMK -TIS-2640824, ZFMK -TIS-2640825, ZFMK -TIS-2640826, ZFMK -TIS-2640827. • 1 ♀; Hesse, Rheingau-Taunus, Lorch am Rhein, above Nollig castle; 50.0495 ° N, 7.7966 ° E; ca 250 m a. s. l.; 12–17 Jun. 2015; Niehuis, Oliver leg.; Malaise trap; MF 3; ZFMK -TIS-2629252. • 3 ♂♂; same collection data as for preceding 17–25 Jun. 2015; ZFMK -TIS-2628232, ZFMK -TIS-2629212, ZFMK -TIS-2629213. • 1 ♀; Hesse, Rheingau-Taunus, Lorch am Rhein, above Nollig castle; 50.0498 ° N, 7.7974 ° E; ca 260 m a. s. l.; 27 May- 7 Jun. 2013; Niehuis, Oliver leg.; Malaise trap; MF 2; ZFMK -TIS-2629266. • 2 ♀♀; same collection data as for preceding 7–15 Jun. 2013; ZFMK -TIS-2628233, ZFMK -TIS-2629250. • 5 ♀♀; same collection data as for preceding 15–23 Jun. 2013; ZFMK -TIS-2629269, ZFMK -TIS-2629270, ZFMK -TIS-2629271, ZFMK -TIS-2629501, ZFMK -TIS-2629502. • 7 ♂♂; same co