Generation of a vIL-4 deletion mutant.

(A) Schematic of the ILTV D-type genome, showing the unique long (UL) and unique short (US) regions flanked by inverted repeats (internal repeat short [IRS] and terminal repeat short [TRS]). (B) Gene organization at the UL/TRS junction, indicating gene direction. (C) The vIL-4 locus, with exons (arrows connected by lines) and their corresponding coordinates based on GenBank entry JN542533: Exon 1 (114,156–114,302), Exon 2 (114,422–114,468), Exon 3 (114,629–114,768), and Exon 4 (114,919–115,028). White triangles indicate the guide RNA (gRNA) binding sites. Black triangles denote the locations of forward (F1-4, TAAGGCCGCAATTAGGTGCT; 113,787–113,806) and reverse (R1-4, AGCCCCGTTGACTTTAGCTT; 115,278–115,259) oligonucleotide primers used for amplicon generation. (D) Sanger sequencing data of an amplicon from plaque-purified ΔvIL-4 mutant (#17). Arrows denote the position of the deletion. (PDF)