First Report of Root-Knot Nematode, <i>Meloidogyne enterolobii</i> , on <i>Siraitia grosvenorii</i> in Guangxi, China

Siraitia grosvenorii (S. grosvenorii) belongs in the Cucurbitaceae Juss family and produces a fruit that is an economically important medicinal and sweetener crop in Guangxi, China (Guo et al. 2024). In April 2023, S. grosvenorii plants exhibiting stunted growth, wilted leaves and root galls were observed at the research farm of the Guangxi Institute of Botany in Guilin, Guangxi, China (GPS 25°4'58.7"N, 110°18'44.6"E) during a disease investigation survey. In the surveyed area, nearly 90% of S. grosvenorii plants showed these symptoms which were apparently caused by an undetermined species of root-knot nematode. Root samples from 20 S. grosvenorii plants revealed extensive galling and egg masses. Nematodes at various growth stages were extracted from the root samples by the shallow dish method and morphological identification was carried out. Females exhibited a spherical to pyriform shape with a distinct short neck. The perineal pattern was elliptical with rounded termini, exhibiting fine, smooth striae and a high dorsal arch. The second-stage juveniles (J2) were slender, with a conical tail terminus bearing a distinct hyaline region that ended bluntly rounded. Morphological measurements (mean, standard deviation, and range) of J2s (n = 20) included body length = 467.8 ± 17.0 (434.4 to 489.4) µm, body width = 22.0 ± 0.8 (20.5 to 23.4) µm, stylet length = 15.7 ± 0.8 (14.1 to 16.7) µm, tail = 42.2 ± 3.2 (36.9 to 47.7) µm. Measurements of females (n = 20) were: body length = 627.7 ± 42.2 (568.5 to 672.5) µm, body width = 494.5 ± 42.4 (440.8 to 556.7) µm. The observed characteristics of Meloidogyne enterolobii aligned with those documented by Yang and Eisenback (1983) and EPPO (2016). J2s that hatched from a single egg mass were used for DNA extraction and molecular identification. Using D2A/D3B (5’-ACAAGTACCGTGAGGGAAAGT/TCGGAAG GAACCAGCTACT-3’), the D2-D3 expansion segment of 28S rDNA region was obtained and sequenced (Subbotin et al. 2006). The target product was 759 bp (GenBank accession no. PV983999), which was 100% homologous to the M. enterolobii sequences available in GenBank (KX823400 and KX823397). For further confirmation, species identification was validated using the M. enterolobii-specific primers MK7-F/MK7-R (GATCAGAGGCGGGCGCATTGCGA /CGAACTCGCTCGAACTCGAC) (Tigano et al. 2010). An expected PCR fragment of approximately 520 bp was amplified; this fragment is absent in populations of M. incognita and M. arenaria (Tigano et al. 2010). Thus, the unknown nematode was conclusively identified as M. enterolobii. To perform Koch’s postulates, 20 healthy S. grosvenorii seedlings were grown in sterile soil until they developed 4 - 6 functional leaves. The seedlings were artificially inoculated with J2s of the original population of M. enterolobii at an inoculum density of 2,500 J2s per plant (n = 10), while 10 control seedlings were treated with sterile water. After 60 days of cultivation in a greenhouse at 26 ℃ with a 13-hour photoperiod, plant roots were observed for nematode symptoms. Non-inoculated plants exhibited no root galls and grew well, whereas all J2-inoculated plants developed field-typical root galls. The average root-knot rating for the inoculated group was 6.1 (on a scale of 0 to 10) (Bridge and Page 1980), confirming the pathogenicity of M. enterolobii to S. grosvenorii. To our knowledge, this is the first report of S. grosvenorii as a new host for M. enterolobii in China. Furthermore, M. enterolobii has been documented to infect several cucurbit hosts, including watermelon, cucumber, and Luffa cylindrica. Given its broad host range and high pathogenicity, M. enterolobii readily infects the roots of S. grosvenorii in cultivation, leading to stunted growth and diminished economic returns. Consequently, it may pose a significant threat to S. grosvenorii production in the future. Further monitoring and the development of effective management strategies are thus warranted.