Sodium-Glucose Cotransporter (SGLT) Protein Expression in Glomerular Cells

Background: Sodium glucose co-transporter (SGLT)2 blockers have been demsontrated to be renoprotective consistently by many clinical trials in the past decade. There is growing interest in exploring the mechansims of SGLT2 blockers in preserving GFR. Specifically, it is unclear if these agents have a direct effect on glomerular components. We hypothesised that apart from indirect effects through hemodynamic changes, SGLT2 blockers may impact glomerulr function by direct effect on SGLT2 proteins in the glomerular cells. Methods: To test our hypothesis, we cultured rat mesangial cells (RMC) in DMEM medium under high glusose (25mM) labeled as HG to simulate diabetic melieu and normal glucose (5.5 mM) labeled as LG. We used cultured proximal tubular epithelial cells (TKPTS) as controls since both SGLT1 and 2 proteins are known to be expresssed in them. After confluence, the total RNA was isolated from harvested cells using an Invitrogen PureLink™ RNA Mini Kit. .qPCR was carried out using Applied Biosystems™ PowerUp™ SYBR™ Green Master Mix (Thermo Fisher Scientific). The primers used for the tested genes are as follows: (A) SGLT1: Forward - TCTGTAGTGGCAAGGGGAAG, Reverse - ACAGGGCTTCTGTGTCTTGG; (B) SGLT2: Forward - GGTGCCTGGCTGGAAAGAATCTG, Reverse - TGCCACCTCATCTGGGTAGAGAATG; and (C) β-actin: Forward - TGTCCACCTTCCAGCAGATGT, Reverse - AGCTCAGTAACAGTCCGCCTAGA. The threshold cycle (Ct) value of each sample was calculated, and the expression of the target gene mRNA relative to the internal control β-actin was determined by the 2−ΔΔCt method. Results: As expected, TKPTS cells expressed both SGLT 1 and 2 mRNA by qPCR technique.. However of interest, inTKPTS cells, the expression of SGLT1 was much higher than SGLT2, which could be due to preponderance of cells from S3 segment origin. In RMC, there was significant expression of SGLT2 with undetectable SGLT1. In both RMC and TKPTS the expression of SGLT 1 and 2 mRNA by qPCR did not change in the presence of high glucose (HG groups). Conclusion: This is the first evidence of SGLT2 protein expression in glomerular mesangial cells, which warrants further research into their functional significance. Funding: Private Foundation SupportSGLT 1 and 2 mRNA exression by qPCR in tubular epithelial and mesangial cells in culture