First Report of Tomato Spotted Wilt Virus Infecting <i>Panax notoginseng</i> in Wenshan, China

Panax notoginseng (Burk.) F.H. Chen in the family Araliaceae is a widely used traditional Chinese medicine for its abilities to improve blood circulation and ameliorate hemostasis (Wang et al. 2016). In July 2024, P. notoginseng plants exhibiting chlorotic spots and yellowing on the leaves were observed in four separate fields of 0.5-1.2 ha, with average 7% disease incidence in the surveyed fields in Wenshan County, Yunnan Province, China. Tospovirus-like particles, measuring from 65 to 100 nm in diameter, were observed by electron microscopy in crude sap prepared from symptomatic leaf tissue excised in 2.5% isoamyl alcohol, followed by negative staining with 2% ammonium molybdate (pH 6.5) (Hu et al., 2023). No virion was observed in the sap of asymptomatic plants. To identify the causal viruses of the disease, leaves of twenty-four symptomatic and three asymptomatic plants were collected from Wenshan, China. Total RNA was then extracted using Eastep® Super Total RNA Extraction Kit (Promega, Shanghai, China). The presence of tomato spotted wilt virus (TSWV) was verified via the method descripted by Huang et al (2018). Two pairs of specific primers, i.e. TZSV-N-F/N-R (5′-ATGTCTAACGTCCGGAGTTTAACA-3′/5′-AAAAGACAGATCATTGCTGCTCTT-3′) and TSWV-N-2300F/2300R (CGGGATCCATGTCTAAGGTTAAGCTCAC/5′-GCTCTAGATTAAGCAAGTTCTGCAAGTTTT-3′), were used to amplify the N genes of tomato zonate spot virus (TZSV) and TSWV by one step RT-PCR, respectively. Twenty-two symptomatic out of 27 samples tested positive for TSWV only, and negative for TZSV. Twenty-two PCR products were sequenced by Sanger sequencing (Sangon, China). Blastn search showed that the obtained 796-nt fragments shared ≥98.00% nt identity with TSWV isolate YKMiSFQ1 (MW404245.1) from Tamarillo. To obtain the complete genome of this TSWV isolate, named TSWV-notoginseng, we conducted overlapping RT-PCR with TSWV-specific primers listed in the supplementary material (Table S1). L, M, and S segments of the TSWV-notoginseng genome were determined to be 8913 nt, 4773 nt and 2972nt, respectively, and the sequences were deposited in GenBank (PV540053, PV540054, and PV540055). The Blastn analysis revealed that three segments (L, M, and S) of the TSWV-notoginseng genome exhibited sequence identities of 99.5%, 99.5%, and 98.0%, respectively, with the L segment of the TSWV-YN5577 strain (isolated from Tropaeolum majus MF422032.1; Yu et al. 2021), the M segment of the TSWV-YNHS strain (isolated from Arachis hypogaea, MN365035.1), and the S segment of the TSWV-Celery strain (isolated from celery,KU356854.1). Three segments of TSWV-notoginseng genome originated from three different isolates of TSWV, indicating TSWV-notoginseng isolate may be a reassortant. To further confirm the possibility that P. notoginseng is a natural host of TSWV, leaf extract of TSWV-notoginseng infected plant was mechanically inoculated on the leaves of one-year-old P. notoginseng plants. Systemically infected leaves of the inoculated plants exhibited chlorotic spots and yellowing symptoms at 14 days post inoculation. TSWV-notoginseng infection was confirmed by RT-PCR using the primer pairs TSWV-N-2300F/2300R, followed by Sanger nucleotide sequencing (Sangon, China). TSWV (family Tospoviridae) can infect more than 1,000 species of plants (Pappu et al. 2009). Our results suggest that TSWV has been expanding the host range through genetic reassortment.