Echinococcus granulosus in Environmental Samples: A Cross-Sectional Molecular Study

Abstract Introduction Echinococcosis, caused by tapeworms of the Echinococcus genus, remains a significant zoonotic disease globally. The disease is particularly prevalent in areas with extensive livestock farming. Humans primarily acquire infection through consumption of contaminated food or water, often from environmental contamination by definitive host feces. This study aimed to detect the presence of E. granulosus DNA (deoxyribonucleic acid) in water and vegetable samples collected from Sulaymaniyah Governorate, Iraq. Methods A cross-sectional study was conducted in Sulaymaniyah Governorate, Iraq, in April 2025. Water and vegetable samples were collected from both urban and rural areas. DNA extraction was performed from all samples, and E. granulosus DNA was explored using a qPCR (quantitative polymerase chain reaction) assay. Sample processing included filtering water, washing vegetables, and DNA extraction under optimized conditions. Results A total of 245 samples, comprising 98 (40.0%) water samples and 147 (60.0%) vegetable samples, were analyzed, with 111 (45.3%) from urban and 134 (54.7%) from rural areas. Despite the comprehensive sampling, no E. granulosus DNA was detected in any sample. All control reactions yielded positive results, but no amplification was observed in the field samples, indicating the absence of E. granulosus contamination. Conclusion This study found no evidence of E. granulosus DNA in water or vegetable samples from Sulaymaniyah, Iraq, suggesting a low likelihood of environmental contamination in this region. but seasonal changes, the restricted sample size, and methodological limitations mean that the presence of contamination cannot be completely excluded. Introduction Echinococcosis is a globally prevalent zoonotic disease caused by the larval or adult stages of tapeworms belonging to the genus Echinococcus (family Taeniidae). Recognized as one of the oldest documented human infections, its history dates to Hippocrates. The two primary forms affecting humans are cystic echinococcosis, also known as hydatid disease or hydatidosis, caused by Echinococcus granulosus, and alveolar echinococcosis, caused by Echinococcus multilocularis [1]. Echinococcosis has a worldwide distribution, with higher prevalence reported in areas such as Eastern Europe, South Africa, the Middle East, South America, Australia, and the Mediterranean, where livestock farming is widespread [1]. In some communities, the human incidence exceeds 50 cases per 100,000 person-years, with prevalence rates ranging from 5% to 10%. The World Health Organization (WHO) identifies CE as one of the major foodborne parasitic diseases globally [2]. Domestic dogs are the main definitive hosts for both Echinococcus species and represent the greatest risk for transmitting cystic and alveolar echinococcosis to humans. Dogs acquire infection by consuming livestock offal containing hydatid cysts and subsequently shed parasite eggs in their feces, which contaminate the environment, including soil, water, and grazing areas. Livestock become infected by ingesting these eggs while grazing, and humans are typically infected through the consumption of contaminated food or water [1]. Hydatid cysts can develop in nearly any organ, though the liver is most commonly affected (approximately 75%), followed by the lungs (15%), with rare involvement of the brain (2%) and spine (1%). Early stages of infection are often asymptomatic, with clinical manifestations emerging only when cysts enlarge or become complicated [3]. Environmental contamination with Echinococcus eggs can be substantial in endemic areas with high definitive host prevalence, creating a risk for human infection. However, contamination through food and the environment has long been overlooked, even though ingestion of infective eggs from these sources is the primary route of human infection [4]. This study aimed to detect the presence of E. granulosus DNA (deoxyribonucleic acid) in water and vegetable samples collected from both urban and rural areas of Sulaymaniyah Governorate, Iraq, using a sensitive qPCR (quantitative polymerase chain reaction) assay. All references were assessed using trusted predatory journal lists to verify their scholarly integrity [5]. Methods Study design A cross-sectional study design was employed. Water and vegetable samples were collected in April 2025 from multiple sites across Sulaymaniyah Governorate, Iraq. Sampling sites were randomly selected across the area to ensure the representativeness of both urban and rural areas. Sampling was conducted under sterile conditions, and all collected material was immediately transferred to the molecular biology department at Smart Health Tower for laboratory processing. Sample collection Water samples were collected directly from rivers, irrigation canals, and storage sources into sterile polypropylene containers. For each randomly selected site, one liter of water was obtained using sterile polypropylene containers. Vegetable samples, including commonly consumed leafy greens and root crops. Approximately 200 g per sample was collected using sterile gloves and placed in clean polyethylene bags. All containers and bags were clearly labeled with the date, site of collection, and sample type. Samples were maintained at 4–8 °C in insulated boxes with ice packs and processed within 6 h of collection. Sample processing Upon arrival at the laboratory, water samples were filtered through sterile membrane filters to concentrate parasitic elements. The residues retained on the filters were rinsed with sterile phosphate-buffered saline (PBS) (pH 7.4) and collected for downstream analysis. Vegetable samples were washed by agitation in 500 mL sterile PBS for 10 minutes at 150 rpm. The wash solutions were collected and centrifuged at 3,000 × g for 10 minutes. Resulting pellets were retained for downstream molecular examination. To enhance DNA extraction efficiency, the pellets were subjected to mechanical disruption using a sterile mortar and pestle under liquid nitrogen, followed by three freeze–thaw cycles between liquid nitrogen (–196 °C) and a 37 °C water bath. This process facilitated rupture of eggshells or larval teguments, releasing nucleic acids for downstream extraction. The homogenate was then processed immediately for DNA extraction. DNA extraction Genomic DNA was extracted using the PureLink Genomic DNA Mini Kit (K1820-01, Invitrogen, Thermo Fisher Scientific, USA) according to the manufacturer’s instructions, with modifications adapted for E. granulosus. The procedure included sequential steps of lysis, binding, washing, and elusion. During the lysis step, the processed samples were incubated with Genomic Lysis/Binding Buffer and Proteinase K at 55–60 °C until complete digestion was achieved. RNase A was added during this stage to eliminate RNA contaminants. Following lysis, ethanol was added to the lysates, which were then transferred to silica-based spin columns. The washing step involved sequential treatment with PureLink Wash Buffer 1 and Wash Buffer 2 to remove salt, proteins, and other contaminants. A final dry spin was performed to eliminate residual ethanol. For elusion, PureLink Genomic Elution Buffer was added to the columns, and DNA was released into sterile collection tubes following centrifugation. DNA quality assessment The quality and concentration of the extracted DNA were evaluated using a spectrophotometer (NanoDrop, Thermo Fisher Scientific, USA). Absorbance was measured at 260 nm and 280 nm to determine purity. Purity assessment was performed by calculating the A260/A230 ratio, with acceptable values ranging between 1.9 and 2.2. DNA integrity was further confirmed by electrophoresis on a 1% agarose gel prepared in 1X Tris-borate-EDTA buffer and stained with ethidium bromide. Bands were visualized under ultraviolet illumination, and intact high-molecular-weight bands were taken as indicators of high-quality genomic DNA. Preparation of primers and probes Primers and probes were prepared according to the manufacturer’s instructions (Sigma-Aldrich). Stock solutions for each primer and probe were resuspended in nuclease-free water, briefly vortexed, and centrifuged. Working solutions were prepared by diluting the stock solutions 1:10 in nuclease-free water. qPCR reaction mixture preparation Luna Universal Probe qPCR Master Mix and other reaction components were thawed at room temperature and then placed on ice. Each component was briefly mixed by inversion and gentle vortexing. Reaction mixtures were prepared for the required number of samples, including 10% overage. For each 20 µL reaction, the following components were combined: 10 µL Luna® Universal Probe qPCR Master Mix (2X), 1 µL Cox3 forward primer (10 µM), 1 µL Cox3 reverse primer (10 µM), 0.5 µL Cox3 probe-FITC (10 µM), 1 µL template DNA (20–100 ng/µL), and 6.5 µL nuclease-free water (Table 1) [6,7]. The mixture was gently mixed and centrifuged briefly to collect the solution at the bottom of the tube. Aliquots were dispensed into qPCR tubes or plates, and DNA templates were added. Tubes or plates were spun briefly at 2,500–3,000 rpm to remove bubbles. Table 1. Primers and Probe for E. granulosus (cox3 gene). Target Species Target gene Primer and probe GenBank reference Oligonucleotide sequence (5’–3’) Target size (bp) Reference Echinococcus granulosus s.s Cytochrome oxidase subunit III Eg_cox3_Forward AF297617.1(UK) (Le et al. 2002) [7] TATCTGTAACACCACAAAACTCAAACC 149 Knapp et al. 2023 [6] Eg_cox3_Reverse CGTTGGAGATTCCGTTTGTTG Eg_cox3_Probe AACAAAAGCAAATCACAACAACGTCAACCC qPCR cycling conditions Real-time qPCR was performed using the following thermal profile: initial denaturation at 95 °C for 60 seconds, followed by 40–45 cycles of 95 °C for 15 seconds and 60 °C for 30 seconds, with fluorescence readings collected at the extension step in the Fluorescein Isothiocyanate (green) chann