Synthetic guide sequence to generate CRISPR-Cas9 entry strains in C. elegans

CRISPR/Cas9 genome editing has become an important and routine method in <i>C. elegans</i> research to generate new mutants and endogenously tag genes. One complication of CRISPR experiments is that the efficiency of single-guide RNA sequences can vary dramatically <i>.</i> One solution to this problem is to create an intermediate entry strain using the efficient and well-characterised <i>dpy-10</i> guide RNA sequence. This "d10 entry strain" can then be used to generate your knock-in of interest. However, the <i>dpy-10</i> sequence is not always suitable when creating an entry strain. For example, if your gene of interest is closely linked to <i>dpy-10</i> on LGII or if you want to use the <i>dpy-10</i> as a co-CRISPR marker for the creation of the entry strain then you can not use the <i>dpy-10</i> sequence. This publication reports a synthetic guide sequence, GCTATCAACTATCCATATCG, that is not present in the <i>C. elegans</i> genome and can be used to create entry strains. This guide sequence is demonstrated to be relatively robust with a knock-in efficiency that varies from 1-11%. While this is lower than the efficiency observed with <i>d10</i> entry strains, it is still sufficient for most applications. This guide sequence can be added to the <i>C. elegans</i> CRISPR toolkit and is particularly useful for generating entry strains where the standard <i>dpy-10</i> guide sequence is not suitable.