Diseñar in silico los sgRNAs del gen VEGF-B

The VEGF-B gene was entered into the NCBI (nucleotide), the article under study is Human vascular endothelial growth factor B 186 (VEGF-B) precursor, mRNA, complete cds. Through the ensembl, the verification of the gene sequence was carried out and the information on the codons was available. In ensembl, the exonic regions are observed (deeper red letters) and what is not highlighted are the introns. In the NCBI, the exonic regions and matured introns are seen, in the ensemble the dispersed exons and introns are observed. Verification of the complete coding sequence and translation start codon (atg) has been carried out, having the complete coding sequence (cds) the design of the sgRNA has been ensured. Through benching, the design of the sgRNA has been carried out, a new project has been created, the VEGFB gene guide has been entered into crispr, it has been specified for the Homo sapiens organism, the PAM sequence is NGG. The highest score has been considered (55.7), the highest off target has been considered (52.6) and the highest on target (53.2). By means of the nucleotide blast, the GTGCGGCGAGCAGCAGGCGG sequence has been obtained. The analysis has found complementarity with the organism under study, the E-value (0.009) and Query cover (100%), confirming that the sequence is highly specific. Cloning was carried out using the SnapGene program. Previously, the enzyme BgLII was added to the sequence (GTGCGGCGAGCAGCAGGCGG) at the 5' site (the AGATCT sequence was incorporated) and the enzyme was added to the 3' site. BamHI (GATCC sequence has been incorporated). The final sequence is 5'AGATTCTGTGCGGCGAGCAGCAGGCGGGATCC 3'. This sequence has been entered into SnapGene, in New DNA File the sequence has been copied. After this practice, the final result was the cloning of the segRNA in the plasmid. Obtaining a 25bp sgRNA and a final product of 5282bp.