The rice orobanchol synthase catalyzes the hydroxylation of the noncanonical strigolactone methyl 4‐oxo‐carlactonoate

The plant hormone strigolactone (SL) is a main regulator of various growth and developmental processes, such as shoot branching/tillering, stem thickness, leaf senescence, and root development (Al-Babili & Bouwmeester, 2015; Wang et al., 2024). Accordingly, SL-deficient mutants, such as the rice d17, exhibit severe phenotypes with respect to shoot and root architecture, among others (Al-Babili & Bouwmeester, 2015; Butt et al., 2018; Wang et al., 2024). Moreover, SLs play a pivotal role in both biotic and abiotic stress responses (Korek & Marzec, 2023). However, SLs were initially discovered in root exudates as germination signals for root parasitic weeds (Cook et al., 1966). Later, released SLs were identified as hyphal branching stimulants involved in the establishment of the beneficial symbiosis with arbuscular mycorrhizal fungi (AMF) under insufficient nutrient, particularly phosphate (Pi), conditions (Akiyama et al., 2005; Lanfranco et al., 2018; Wang et al., 2024). Structurally, SLs are characterized by a particular feature, a butenolide ring (D-ring; Fig. 1) linked to variable structures by an enol ether bridge in R-configuration, which is essential for their biological activity (Al-Babili & Bouwmeester, 2015; Yoneyama et al., 2018). Based on the presence or absence of a tricyclic lactone (the ABC-ring; Fig. 1), they are additionally classified into canonical and noncanonical SLs, respectively (Yoneyama et al., 2018; Wang et al., 2024). The SL-biosynthetic pathway starts with a reversible conversion of all-trans-β-carotene into 9-cis-β-carotene by the isomerase DWARF27 (D27). Subsequently, two carotenoid cleavage dioxygenases (CCDs), CCD7 and CCD8, convert successively 9-cis-β-carotene into carlactone (CL), the intermediate of SL biosynthesis (Alder et al., 2012; Bruno et al., 2014, 2017; Seto et al., 2014; Chen et al., 2022). Up to now, there are more than 35 characterized natural SLs, with a structural diversity resulting from the modification of CL by cytochrome P450 monooxygenases (CYP), including the MORE AXILLARY GROWTH1 (MAX1) from the 711A clade, and other enzymes (Yoneyama et al., 2018; Ito et al., 2022; Chen et al., 2023; Wang et al., 2023, 2024). In rice, OsMAX1-900 repeatedly oxygenates CL to produce the canonical SL 4-deoxyorobanchol (4DO) that is further hydroxylated into orobanchol (Oro) by another CYP711A enzyme OsMAX1-1400, the orobanchol synthase (also known as 4-deoxyorobanchol hydroxylase) (Zhang et al., 2014; Ito et al., 2022; Chen et al., 2023; Fig. 1). In rice, the canonical SL pathway has been well investigated, while the biosynthesis of noncanonical SLs remains largely elusive. Apart from its involvement in the biosynthesis of canonical SLs, OsMAX1-900, together with unidentified methyltransferase(s), converts the putative noncanonical SL 4-oxo-19-hydroxy-CL (CL + 30) into methyl 4-oxo-carlactonoate (4-oxo-MeCLA), a tentatively identified noncanonical SL that was previously described as methoxy-5-deoxystrigol isomer (Yoneyama et al., 2018; Ito et al., 2022; Haider et al., 2023). Intriguingly, 4-oxo-MeCLA accumulated in the Osmax1-1400 and Osmax1-900/1400 rice mutants, but not in the Osmax1-900 mutant (Chen et al., 2023), suggesting that 4-oxo-MeCLA might be a substrate for MAX1-1400, and that both MAX1-900 and MAX1-1400 may be involved in the biosynthesis of both canonical and noncanonical SLs. To check the supposed role of MAX1-1400 in 4-oxo-MeCLA metabolism, we expressed the enzyme in yeast, incubated the isolated microsomes with different substrates, and analyzed the product formation by liquid chromatography–tandem mass spectrometry (LC-MS/MS). We also analyzed the root exudates of Osmax1-900 and Osmax1-900/1400 rice mutants, to determine the role of MAX1-1400 in the biosynthesis of noncanonical SLs. Oryza sativa Nipponbare max1-900, max1-900/1400 (Ito et al., 2022; Chen et al., 2023), and wild-type (WT) rice plants were grown under controlled conditions (a 12 h photoperiod, 200-μmol photons m−2 s−1 and day : night temperature of 27°C : 25°C). All rice seeds were first surface-sterilized in a 50% sodium hypochlorite solution for 10 min, then rinsed with sterile water, before being germinated in the dark overnight. The pregerminated seeds were placed on Petri dishes containing ½-strength liquid Murashige & Skoog (MS) medium and incubated in a growth chamber for 7 d. After germination, the seedlings were transferred into 50 ml black falcon tubes filled with low-Pi half-strength modified Hoagland nutrient solution with pH adjusted to 5.8. The nutrient solution consisted of 5.6 mM NH4NO3, 0.8 mM MgSO4·7H2O, 0.8 mM K2SO4, 0.18 mM FeSO4·7H2O, 0.18 mM Na2EDTA·2H2O, 1.6 mM CaCl2·2H2O, 0.8 mM KNO3, 0.023 mM H3BO3, 0.0045 mM MnCl2·4H2O, 0.0003 mM CuSO4·5H2O, 0.0015 mM ZnCl2, 0.0001 mM Na2MoO4·2H2O and 0.004 mM K2HPO4·2H2O. OsCYP711A3 (OsMAX1-1400) gene is amplified from the vector pAG414GPD-OsCYP711A3 (pYL761) (https://www.addgene.org/178300/) by using the primers, OsCYP711A3_OS1400F_Bam HI: ATTGGATCCATGGAAATCATCTCTACCGTTTTG OsCYP711A3_OS1400R2_6XHIS_ECoRI:ATTCCGCGGTTAATGATGATGATGATGatgGGCAGTATGTCTCTTGATGAC, and inserted into the vector pJKW1148 (Plasmid #119029, https://www.addgene.org/119029). Saccharomyces cerevisiae WAT11 yeast cells expressing the ATR1 Arabidopsis NADPH-P450 reductase (Truan et al., 1993; Pompon et al., 1995) were cultivated in complete YPGA medium (10 g l−1 yeast extract, 10 g l−1 bactopeptone, 20 g l−1 glucose, and 200 mg l−1 adenine). Cells transformed with pYeDP60_OsCYP711A3 plasmids using a modified lithium acetate protocol (Gietz et al., 1992) and selected on SGI plates containing Bactocasamino acids 1 g l−1, yeast nitrogen base 7 g l−1, glucose 20 g l−1, and Tryptophane 20 mg l−1. Transformed colonies were grown in 30 ml of SGI medium at 28°C until an OD600 of 0.2. Cultures were then diluted at a ratio of 1 : 100 in YPGE medium (10 g l−1 yeast extract, 10 g l−1 bactopeptone, 20 g l−1 glucose, and 3% (v/v) ethanol) and incubate at 28°C until an OD600 of 0.5. Expression of OsCYP711A3 was induced by adding 10% (v/v) of a 20% (w/v) galactose solution, and cultures were then incubate at 25°C for 16 h. A 1-l culture of S. cerevisiae WAT11 cells was harvested and washed with 90 ml cold buffer TEK consisting of 50 mM Tris/HCl pH 7.5, 100 mM KCl and 1 mM EDTA. Pellets were resuspended in 10 ml cold TES buffer (50 mM Tris/HCl pH 7.5, 1 mM EDTA, 0.6 M sorbitol) containing 1% (w/v) BSA and 0.03% (v/v) β-mercaptoethanol. Glass beads (0.45–0.50 mm diameter) were added until skimming the top of the cell suspension, and cell walls were mechanically disrupted by handshaking for 5 min in the cold room. The extracts were recovered, and the beads were washed using 1 ml of TES buffer. The extracts were centrifuged for 10 min at 3500 g and 4°C. Supernatants were then filtered using Miracloth filter (pore size 22–25 μm; Merck), and centrifuged at 105 g and 4°C for 2 h. Pellets representing the microsomal preparation were resuspended in 3.5 ml cold TEG buffer TEG (50 mM Tris/HCl pH 7.5 containing 1 mM EDTA and 30% (v/v) glycerol) and frozen at −80°C. In vitro assays were performed in a total volume of 500 μl of 10 mM sodium phosphate buffer (pH 7.4), 500 μM NADPH, 2 μM substrate (final concentration), 0.1% (v/v). Two-hundred microliter microsomes were then added and the assay volume was adjusted with water. Incubations were performed for 2 h at 28°C. Assays were extracted by partitioning against two volumes of ethyl acetate. Lipophilic epiphase was dried using a vacuum centrifuge and re-dissolved in 100% acetone for LC-MS analysis. (R)-4DO was purchased from Olchemim, Olomouc, Czech Republic. Methyl 4-oxo-carlactonoate was prepared from previously described alkenylstannane (Woo & McErlean, 2019) and alkenyl iodide (Domínguez et al., 2012), by the Stille-Migita-Kosugi cross-coupling reaction (Stille, 1986; Farina & Roth, 1996; Heravi et al., 2014), which took place at ambient temperature upon addition of catalytic amounts of Pd2dba3 and AsPh3 with CuI as additive in 59% yield. The chemical synthesis procedures and NMR characterization of 4-oxo-MeCLA are listed in Supporting Information Fig. S1. Collection, extraction, and analysis of SLs in rice root exudates were followed the published protocol (Wang et al., 2022b). Briefly, root exudates were extracted with a C18-Fast Reversed-SPE column (500 mg per 3 ml), preconditioned with 3 ml of methanol and followed with 3 ml of Milli-Q water. After washing with 3 ml of water, SLs were eluted with 5 ml of acetone. Thereafter, the SLs-containing fraction was concentrated to SL aqueous solution (c. 500 μl), followed by 1 ml of ethyl acetate extraction. Seven-hundred-and-fifty microliters of SL enriched fraction was dried under vacuum. The final extract was re-dissolved in 100 μl of 100% acetone and filtered through a 0.22 μm filter for LC-MS/MS analysis. The identification of SLs was performed using Vanquish UHPLC-Orbitrap-ID-X Tribrid Mass Spectrometer (Thermo Scientific™, Waltham, MA, USA) with a heated-electrospray ionization source. The IDX Orbitrap-MS was tuned and calibrated using Pierce™ Flex Mix™ Calibration Solution according to the manufacturer's guidelines. Chromatographic separation was achieved on the Hypersil GOLD C18 Selectivity HPLC Columns (150 × 4.6 mm; 3 μm; Thermo Scientific™) with mobile phases consisting of water (A) and acetonitrile (B), both containing 0.1% formic acid, and the following linear gradient (flow rate, 0.5 ml min−1): 0–15 min, 25–100% B, followed by washing with 100% B and equilibration with 25% B for 3 min. The injection volume was 10 μl, and the column temperature was maintained at 30°C for each run. The MS conditions of H-ESI mode were as follows: positive mode, ion source of H-ESI, spray voltage of 3500 V, sheath gas flow rate of 60 arbitrary units, auxiliary gas flow rate of 15 arbitrary units, sweep gas flow rate of 2 arbitrary units, ion transfer tube temperature of 350°C, vaporizer temperature of 400°C, S-lens RF level of 60, resolution of 120 000 for MS; stepped HCD collision energies of 10–50% and resolution of 30 000 for MS/MS. The MS conditions of APCI mode were as follows: ion source of APCI, Pos Ion discharge current 4 μA, sheath gas flow rate of 45 arbitrary units, auxiliary gas flow rate of 10 arbitrary units, sweep gas flow rate of 2 arbitrary units, ion transfer tube temperature of 275°C, vaporizer temperature of 400°C, RF level of 50, resolution of 120 000 for MS; stepped HCD collision energies of 10–50% and resolution of 30 000 for MS/MS. The mass accuracy of the identified compounds (accurate mass ± 5 ppm mass tolerance) was acquired using XCALIBUR software v.4.1. Strigolactones were quantified by LC-MS/MS using a UHPLC-Triple-Stage Quadrupole Mass Spectrometer (Thermo Scientific™ Altis™). Chromatographic separation was the same as above for SL identification. The MS parameters were positive ion mode, ion source of H-ESI, ion spray voltage of 5000 V, sheath gas of 40 arbitrary units, aux gas of 15 arbitrary units, sweep gas of 2 arbitrary units, ion transfer tube gas temperature of 350°C, vaporizer temperature of 350°C, collision energy of 17 eV, CID gas of 2 mTorr. The characteristic multiple reaction monitoring (MRM) transitions (precursor ion → product ion) were 361.16 → 247.12, 361.16 → 177.05, 361.16 → 208.07, 361.16 → 97.028 for 4-oxo-MeCLA; 377.3 → 97.028, 377.3 → 251.13, 377.3 → 251.13, 377.3 → 331.15 for OH-4-oxo-MeCLA; 360.13 → 213.07, 360.13 → 185.07, 360.13 → 97.028 for (OH-4-oxo-MeCLA (−H2O)); 331.15 → 216.0, 331.15 → 234.1, 331.15 → 97.028 for 4-deoxyorobanchol; 347.14 → 329.14, 347.14 → 233.12, 347.14 → 205.12, 347.14 → 97.028 for orobanchol; 333.17 → 219.2, 333.17 → 173.2, 333.17 → 201.2, 333.17 → 97.028 for putative 4-oxo-hydroxyl-CL (CL + 30); 317.17 → 164.08, 317.17 → 97.028 for putative Oxo-CL (CL + 14); 299.09 → 185.06, 299.09 → 157.06, 299.09 → 97.028 for GR24. We first incubated the yeast microsomes containing OsMAX1-1400 with root exudates of WT rice grown hydroponically under constant low-Pi conditions. As expected, we observed a significant decrease in the level of 4DO, accompanied by an enhancement in Oro content (Figs S2, S3). Intriguingly, the content of the putative 4-oxo-MeCLA was also remarkably reduced after incubation, indicating that 4-oxo-MeCLA can also be a substrate for MAX1-1400 enzyme (Figs S2, S4). For unambiguous identification of the conversion product(s), a structurally confirmed 4-oxo-MeCLA is required; therefore, we chemically synthesized this noncanonical SL (Fig. S5) and compared it with the endogenous compound using LC-MS, which allowed us to unambiguously confirm it as a noncanonical rice SL (Fig. 2a). Next, we incubated the MAX1-1400 enzyme with enantiopure (R)-4-oxo-MeCLA (at 2 μM concentration) and used (R)-4DO as a positive control. We again detected an c. 80% reduction in 4DO content and a significant level of Oro produced by MAX1-1400, confirming that MAX1-1400 is a 4DO hydroxylase (Fig. 2b; Zhang et al., 2014; Chen et al., 2023). With respect to 4-oxo-MeCLA, we observed c. 50% decrease in its content, pointing to this noncanonical SL as a further substrate of MAX1-1400. However, we did not detect any potential product(s) in this experiment (Fig. 2b). To identify the product(s), we combined six independent microsome assays, aiming to increase the product concentration, and performed untargeted LC-MS analysis, using void microsomes as a negative control. On the basis of the MS-fragment at 97.02820 (mass/charge ratio (m/z) ± 5 ppm), which is characteristic for the D-ring, we identified a product with a molecular formula C20H25O7 (m/z) 377.16074 as positive ion [M + H]+ in the atmospheric pressure chemical ionization mode (Fig. S6). By using electrospray ionization (ESI) mode, we obtained an accumulated metabolite in the MAX1-1400 sample with a molecular formula C20H24O6 (m/z) 360.13440 ± 5 ppm as positive ion [M + H]+ (Fig. S7), indicating a loss of water [M + H (−H2O)]+. The shift in the molecular mass from 4-oxo-MeCLA (molecular formula C20H25O6; (m/z) 361.16456 ± 5 ppm as positive ion [M + H]+) to the product indicated that MAX1-1400 catalyzes a hydroxylation (–OH) that leads to OH-4-oxo-MeCLA (Fig. S6). To further validate this assumption, we quantified 4-oxo-MeCLA and OH-4-oxo-MeCLA in another independent assay. Interestingly, we observed a significant increase (c. 85%) in OH-4-oxo-MeCLA content accompanied by a c. 97% decrease of the substrate, demonstrating that OH-4-oxo-MeCLA is a metabolite produced by MAX1-1400 in vitro (Fig. 3a). Furthermore, MS/MS fragmentation allowed us to tentatively identify the product as 18-OH-4-oxo-MeCLA (Fig. S8); however, nuclear magnetic resonance (NMR) spectroscopy will be needed to precisely confirm the structure of this noncanonical SL. Recently, we showed that 4-oxo-MeCLA accumulated in rice mutants, such as Osmax1-1400 and Osmax1-900/1400, which are disrupted in MAX1-1400, while it occurred in trace amounts in Osmax1-900 mutants (Ito et al., 2022; Wang et al., 2022a; Chen et al., 2023). This pattern suggests the involvement of MAX1-1400 in metabolizing 4-oxo-MeCLA, and is consistent with the here described in vitro results. To further confirm this conclusion, we analyzed the SLs present in the WT, Osmax1-900, and Osmax1-900/1400 mutants, excluding the potential activity of MAX1-900 in noncanonical SL biosynthesis. As expected, none of the mutants contained detectable amounts of the canonical SLs 4DO and Oro, while both of them accumulated higher levels of the putative CL + 30 and CL + 14 (Oxo-CL), in comparison to the WT (Fig. S9). Interestingly, we did not detect the tentative 18-OH-4-oxo-MeCLA in the root exudates of Osmax1-900/1400, but this noncanonical SL was present in the exudates of Osmax1-900 and WT plants (Fig. 3b). In addition, we observed a higher content of 4-oxo-MeCLA in Osmax1-900/1400, compared to Osmax1-900 (Fig. 3c). These results suggest that OsMAX1-1400 catalyzes the hydroxylation of 4-oxo-MeCLA in planta and that the formation of the tentative 18-OH-4-oxo-MeCLA requires a functional MAX1-1400 (Fig. 3c). Taken together, our work demonstrates that the rice orobanchol synthase, OsMAX1-1400, hydroxylates 4-oxo-MeCLA into a tentative 18-OH-4-oxo-MeCLA in vitro, besides the known hydroxylation of 4DO into Oro. By analyzing the corresponding mutants, we also show that this conversion takes place in planta, depending on OsMAX1-1400. Additionally, our results unarguably reveal the involvement of OsMAX1400 in noncanonical SL biosynthesis and expand the current knowledge of the enzymatic activities of MAX1s and their relation to both SL classes (Fig. 1a). The contribution of canonical SL-biosynthetic enzymes to the formation of noncanonical SLs may occur in other plant species and be related to the evolution of these enzymes. Future work, including the elucidation of SL biosynthesis at the cellular level, will identify the function of 4-oxo-MeCLA and the tentative 18-OH-4-oxo-MeCLA in rice and reveal the biological significance of this conversion. This may first require the elucidation of the biosynthesis of CL + 30, the precursor of 4-oxo-MeCLA. In any case, the accumulation of 4-oxo-MeCLA and/or the lack of tentative 18-OH-4-oxo-MeCLA might be a reason for the reduced AM symbiosis observed in Osmax1-1400 mutants (Chen et al., 2023). We are thankful for the support we received from members of KAUST Analytical Core Lab and the Bioactives lab. This work was supported by baseline funding and CRG2022 from King Abdullah University of Science and Technology (KAUST) and by the Bill & Melinda Gates Foundation (grant no. OPP1136424) given to SA-B. None declared. SA-B and JYW proposed the concept and designed the experiments. JYW, AB and G-TEC discussed and conducted experiments. CM and ARL synthesized 4-oxo-MeCLA. SS and JYW analyzed MS/MS data and proposed the structure. JYW and SA-B analyzed and discussed the data. JYW and SA-B wrote the manuscript. All authors read, edited and approved the manuscript. All data needed to evaluate the conclusions in the paper are present in the paper (Figs 1-3) and/or the Supporting Information (Figs S1–S9). Fig. S1 Experimental procedures for the total synthesis of methyl 4-oxo-carlactonoate. Fig. S2 MAX1-1400 potentially metabolizes both canonical and noncanonical SLs. Fig. S3 Detection of 4DO and Oro in root exudates feeding experiments with recombinant MAX1-1400 in yeast microsomes. Fig. S4 Detection of 4-oxo-MeCLA in root exudates feeding experiments with recombinant MAX1-1400 in yeast microsomes. Fig. S5 Synthesis of methyl 4-oxo-carlactonoate (4-oxo-MeCLA). Fig. S6 Identification of OH-4-oxo-MeCLA. Fig. S7 Detection of OH-4-oxo-MeCLA in 4-oxo-MeCLA feeding experiments with recombinant MAX1-1400. Fig. S8 Proposed structure of tentative 18-OH-4-oxo-MeCLA based on mass fragmentation. Fig. S9 SL quantification of and is not for the content or of any Supporting Information by the than be to the The is not for the content or of any by the than be to the corresponding for the